View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_low_18 (Length: 254)
Name: NF6982_low_18
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 46294503 - 46294739
Alignment:
| Q |
5 |
atgagatggacatcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggctta |
104 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294503 |
atgacatggccatcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggctta |
46294602 |
T |
 |
| Q |
105 |
gagatttgatttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294603 |
gagatttgatttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgt |
46294702 |
T |
 |
| Q |
205 |
tcgtgattgcatttttgctcgtgttggtgcaggtgat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294703 |
tcgtgattgcatttttgctcgtgttggtgcaggtgat |
46294739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University