View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6982_low_19 (Length: 246)

Name: NF6982_low_19
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6982_low_19
NF6982_low_19
[»] chr5 (1 HSPs)
chr5 (30-229)||(8621126-8621326)


Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 30 - 229
Target Start/End: Complemental strand, 8621326 - 8621126
Alignment:
30 attttattgaaactcacatgttagaattgatatcataattagt-catttgtacaactaaaattttatcacagaattctttatttcttttgnnnnnnntgg 128  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||       |||    
8621326 attttattgaaactcacatgttagaattgatatcataattagttcatttgtacaaataaaattttatcacagaactctttatttcttttgaaaaaaatgg 8621227  T
129 agatttggcctagatatataatctattcagtttgtaggattgaatgaaatttataaaactagtcagatatgtgtcttggtagcattcatatatgtggctt 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8621226 agatttggcctagatatataatctattcagtttgtaggattgaattaaatttataaaactagtcagatatgtgtcttggtagcattcatatatgtggctt 8621127  T
229 g 229  Q
    |    
8621126 g 8621126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University