View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6982_low_4 (Length: 412)
Name: NF6982_low_4
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6982_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 7e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 4593766 - 4593963
Alignment:
| Q |
19 |
actacgtggggcagtactcatcaagattttctatgcaaagtatattgtcaagacggtggtgaagttcaaagaggattttttcaatcagttaatggattac |
118 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4593766 |
actacgtggggcagtacccatcaagattttctatgcaaagtatattgtcaagacggttgtgaagttcaaagaggatttt-tcaatcagttaatggattac |
4593864 |
T |
|
| Q |
119 |
ttcaaggaggtgtgcaatcagctatcaacaacatacaacatgaaggacaacaatatcatgtttgtgacattaggcgtagaggatgtggcacaaaaagac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4593865 |
ttcaaggaggtgtgcaatcagctatcaacaacatacaacatgaaggacaacaatatcatgtttgtgacattaggcgtagaggatgtggcacaaaaagac |
4593963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University