View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6982_low_9 (Length: 338)

Name: NF6982_low_9
Description: NF6982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6982_low_9
NF6982_low_9
[»] chr5 (1 HSPs)
chr5 (9-327)||(23587195-23587513)
[»] chr6 (2 HSPs)
chr6 (109-267)||(19897213-19897371)
chr6 (121-203)||(25801518-25801600)
[»] chr3 (1 HSPs)
chr3 (121-267)||(18037934-18038079)
[»] scaffold0434 (1 HSPs)
scaffold0434 (69-179)||(12246-12356)
[»] scaffold0059 (1 HSPs)
scaffold0059 (109-267)||(53219-53376)
[»] chr8 (1 HSPs)
chr8 (167-267)||(22482425-22482525)


Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 9 - 327
Target Start/End: Original strand, 23587195 - 23587513
Alignment:
9 aacctgtgcatatgcaacatcagcagcaatcttgatagttgtttcatcatcagcaaccatgggatccttctcagaagtgccaacattaggtttgacaacg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23587195 aacctgtgcatatgcaacatcagcagcaatcttgatagttgtttcatcatcagcaaccatgggatccttctcagaagtgccaacattaggtttgacaacg 23587294  T
109 gtggagatgaaaggattctccttttcatacaaatcacccatgctcaacgatgtctttgattcaccccttttcgttttaggccccgttttcttcttcgaag 208  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
23587295 gtggagatgaaagtattctccttttcatacaaatcacccatgctcaacggtgtctttgattcaccccttttcgttttaggccccgttttcttcttcgaag 23587394  T
209 tagattttgttgcggttttcttcttagtttttagggaagaaacctttgtgatgggttcacccattttaggaattgaagaactagtttcacgacgttcgga 308  Q
     ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23587395 cagattttgttgcggttttcttcttagttttttgggaagaaacctttgtgatgggttcacccattttaggaattgaagaactagtttcacgacgttcgga 23587494  T
309 gacagagttttctttgatg 327  Q
    |||||||||||||||||||    
23587495 gacagagttttctttgatg 23587513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 109 - 267
Target Start/End: Complemental strand, 19897371 - 19897213
Alignment:
109 gtggagatgaaaggattctccttttcatacaaatcacccatgctcaacgatgtctttgattcaccccttttcgttttaggccccgttttcttcttcgaag 208  Q
    ||||| || |||||||| |||||||| |||| |||  |||| ||||| | |||| |||||||| ||||||| |||||||| || ||||||||||| ||||    
19897371 gtggatataaaaggattttccttttcgtacagatctgccatactcaatggtgtccttgattcatccctttttgttttaggaccagttttcttctttgaag 19897272  T
209 tagattttgttgcggttttcttcttagtttttagggaagaaacctttgtgatgggttca 267  Q
     | | ||||||||  ||||| |||| | |||| |||| |||||| || | |||||||||    
19897271 caaactttgttgccattttcctcttggattttggggatgaaaccgtttttatgggttca 19897213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 25801518 - 25801600
Alignment:
121 ggattctccttttcatacaaatcacccatgctcaacgatgtctttgattcaccccttttcgttttaggccccgttttcttctt 203  Q
    ||||| |||||||| || | |||| |||| ||||| |  |||||||||||||||||||| ||||||||  || ||||||||||    
25801518 ggattttccttttcgtatagatcaaccatactcaaaggcgtctttgattcacccctttttgttttaggagcctttttcttctt 25801600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 267
Target Start/End: Complemental strand, 18038079 - 18037934
Alignment:
121 ggattctccttttcatacaaatcacccatgctcaacgatgtctttgattcaccccttttcgttttaggccccgttttcttcttcgaagtagattttgttg 220  Q
    ||||| ||||||||||| | |||| |||| ||||||| ||||||||||||| ||||||||||||||||  || |||||||||| ||    || || |  |    
18038079 ggattttccttttcatatagatcaaccatactcaacggtgtctttgattca-cccttttcgttttaggagcctttttcttctttgagaccgacttagacg 18037981  T
221 cggttttcttcttagtttttagggaagaaacctttgtgatgggttca 267  Q
     |||| ||||||||| |||| | ||||||||| ||||||||||||||    
18037980 tggttatcttcttagattttggtgaagaaaccgttgtgatgggttca 18037934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0434 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0434
Description:

Target: scaffold0434; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 69 - 179
Target Start/End: Original strand, 12246 - 12356
Alignment:
69 gggatccttctcagaagtgccaacattaggtttgacaacggtggagatgaaaggattctccttttcatacaaatcacccatgctcaacgatgtctttgat 168  Q
    ||||||||||||||||||||||||||| |||| ||||| |||  | | |||||| || |||||||| ||||   || |||||||||  |  |||||||||    
12246 gggatccttctcagaagtgccaacatttggttcgacaatggtaaataggaaagggttttccttttcgtacattccagccatgctcattggggtctttgat 12345  T
169 tcacccctttt 179  Q
    |||||||||||    
12346 tcacccctttt 12356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0059
Description:

Target: scaffold0059; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 109 - 267
Target Start/End: Complemental strand, 53376 - 53219
Alignment:
109 gtggagatgaaaggattctccttttcatacaaatcacccatgctcaacgatgtctttgattcaccccttttcgttttaggccccgttttcttcttcgaag 208  Q
    ||||| || |||||||| |||||||| |||| |||  ||| | |||| | |||| || ||||||||||||  |||||||| |||||||||||||| ||||    
53376 gtggatataaaaggattttccttttcgtacagatctgccaag-tcaatggtgtccttaattcacccctttatgttttaggacccgttttcttctttgaag 53278  T
209 tagattttgttgcggttttcttcttagtttttagggaagaaacctttgtgatgggttca 267  Q
     ||| ||||||||  |||||  |||   |||| |||| |||||| ||||||||||||||    
53277 cagactttgttgcaattttccccttgaattttggggatgaaaccattgtgatgggttca 53219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 267
Target Start/End: Complemental strand, 22482525 - 22482425
Alignment:
167 attcaccccttttcgttttaggccccgttttcttcttcgaagtagattttgttgcggttttcttcttagtttttagggaagaaacctttgtgatgggttc 266  Q
    ||||||||||||| |||||| | |||||||||||||| |||| ||| ||||  ||  ||||| |||| | |||| |||| |||||  |||||||||||||    
22482525 attcacccctttttgttttaagacccgttttcttctttgaagcagactttgccgcaattttcctcttggattttggggatgaaactgttgtgatgggttc 22482426  T
267 a 267  Q
    |    
22482425 a 22482425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University