View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6983_high_18 (Length: 239)
Name: NF6983_high_18
Description: NF6983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6983_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 32883977 - 32884180
Alignment:
| Q |
20 |
gtatgcagaatttgaaccatggttatgtctaatatagatggctcaggtaggagtttagtatcgtaatgtgaccaaatataaaccttaaaactcggaagta |
119 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32883977 |
gtatgcagaatttgaaccatggctacgtctaatatagatggctcaggtaggagtttggtatcgtaatgtgaccaaatataaaccttaaaactcggaagta |
32884076 |
T |
|
| Q |
120 |
cgaaattgtggtcaatgagttattcttatgaagttttatagctcatatatttactctttactgtaacttctaatgaccatgttctgatcaaaatcctggc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32884077 |
cgaaattgtggtcaatgagttattcttatgaagttttatagctcatttatttactcttcactgtaacttctaatgaccatgttctgatcaaaatcctggc |
32884176 |
T |
|
| Q |
220 |
acag |
223 |
Q |
| |
|
|||| |
|
|
| T |
32884177 |
acag |
32884180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University