View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6983_low_16 (Length: 326)
Name: NF6983_low_16
Description: NF6983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6983_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 202 - 249
Target Start/End: Original strand, 12470272 - 12470319
Alignment:
| Q |
202 |
gtgttgaattcctctgtttccatcgctcttcctttcctttgtgtgtcg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12470272 |
gtgttgaattcctctgtttccatcgctcttcctttcctctgtgtgtcg |
12470319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 49
Target Start/End: Original strand, 12470090 - 12470120
Alignment:
| Q |
19 |
aattcctcttctcttattatcgtacagattg |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12470090 |
aattcctcttctcttattatcgtacagattg |
12470120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University