View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6983_low_18 (Length: 266)
Name: NF6983_low_18
Description: NF6983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6983_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 52726371 - 52726132
Alignment:
| Q |
18 |
atagctaatcctcaaatgaaatttagctaaaggagtattacaattagataata---tacaccgatgaatacaaacaatgccattgcgaagtaaccatata |
114 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52726371 |
atagccaatcctcaaatgaaatttagctaaaggagtattacaattagataataatatacaccgatgaatacaaacaatgccattgcgaagtaaccatata |
52726272 |
T |
|
| Q |
115 |
gagcaaaggtattaagaaactattacttacgaattggagaattatatattatttgttgaagttcctaataacttgcccttgcaaatcaattgaccgaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52726271 |
gagcaaaggtattaagaaactattacttacgaattggagaattatatattatttgttgaagttcctaataacttgcccttgtaaatcaattgaccgaaag |
52726172 |
T |
|
| Q |
215 |
ttttgggatgcactaaatcttagataaaaagaacaagtat |
254 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52726171 |
ttttgagatgcactaaatcttagataaaaagaacaagtat |
52726132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University