View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6983_low_8 (Length: 442)
Name: NF6983_low_8
Description: NF6983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6983_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 17 - 427
Target Start/End: Complemental strand, 38385172 - 38384762
Alignment:
| Q |
17 |
actatcaactccatatgctgttgaaaaaggagggtgggcatctaccttattgctagtaggacttggggtaatctgtgcttatacctcacatatacttgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38385172 |
actatcaactccatatgctgttgaaaaaggagggtgggcatctaccttattgctagtaggacttggggtaatctgtgcttatacctctcatatacttgga |
38385073 |
T |
 |
| Q |
117 |
aaatgtcttgaaaagaatccaaagttaacaagttatgtggatattgggattcaagcatttggatcaaagggaagattcttagttgcaacattcatctaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38385072 |
aaatgtcttgaaaagaatccaaagttaacaagttatgtggatattgggaatcaagcatttggatcaaagggaagattcttagttgcaacattcatctaca |
38384973 |
T |
 |
| Q |
217 |
tggaaatcttcatgtcacttgtttcctacaccatctcattacatgacaacttgatcatagtatttttggggacacatctgaagctgaaattggccatatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38384972 |
tggaaatcttcatgtcacttgtttcctacaccatctcattacatgacaacttgatcatagtatttttggggacacatctgaagctgaaattggccatatt |
38384873 |
T |
 |
| Q |
317 |
atcaacatcacagctcttaactttggtggcagtcttgattgctctgcctagtttgtggatcagagatttgtcttctatatcttttctttcatctcttggt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38384872 |
atcaacatcacagctcttaactttggtggcagtcttgattgctctgcctagtttgtggatcagagatttgtcttctatatcttttctttcatctcttggt |
38384773 |
T |
 |
| Q |
417 |
attctgatgtc |
427 |
Q |
| |
|
||||| ||||| |
|
|
| T |
38384772 |
attcttatgtc |
38384762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University