View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6986_high_15 (Length: 269)
Name: NF6986_high_15
Description: NF6986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6986_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 2 - 172
Target Start/End: Complemental strand, 4247337 - 4247174
Alignment:
| Q |
2 |
gacttggcaaatctttgttgattgtgatttttgggacttgggagtaagtattgatcaatgaggtgtgatcgtaaggcgtgcatgttgtgtannnnnnnnn |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4247337 |
gacttggcaaatctttgttgattgtgatttttgggacttgggagtaagtattg----atgaggtgtgatcgtaaggcgtgcatgttgtgt--tttttttt |
4247244 |
T |
 |
| Q |
102 |
nnnnngaccttcctcttctcatgacaaatgtttatagtaatccagagtttggtcacgaagtaaatatagtc |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||| || ||||||| |||| |
|
|
| T |
4247243 |
tttttgaccttcctcttctcatgagaaatgtttatagtaat-cagagtttggtcaggaggtaaataaagtc |
4247174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 268
Target Start/End: Complemental strand, 4247134 - 4247078
Alignment:
| Q |
212 |
ctcttgaagaaattgtctttgttggaattcatttaaccacctatatcttattacttg |
268 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4247134 |
ctcttaaataaattgtctttgttggagttcatttaaccacctatatcttattacttg |
4247078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University