View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6986_low_17 (Length: 267)
Name: NF6986_low_17
Description: NF6986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6986_low_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 35667373 - 35667623
Alignment:
| Q |
18 |
ttttacgggaaatgagtagctcatttgattgagttaagagattaaacaagttaaagaattaaggtctag-gcgtttgtattttgaaaatgaaacnnnnnn |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
35667373 |
ttttacgggaaatgagtagctcacttgattgagttaagagattaaacgagttaaagaattaaggtctagagcgttggtattttgaaaatgaaacaaaaaa |
35667472 |
T |
|
| Q |
117 |
ntgttaacataacaaatagcatttgccattaaataaataatactccgacatgcttatgctctccttataaatagaggatacaattgtacgagcttataga |
216 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35667473 |
atgttaacataacaattaacatttgccattaaataaataatactccaacatgcttatgctctccttataaatagaggatacaattgtacgagcttataga |
35667572 |
T |
|
| Q |
217 |
accgatcatgttcaagcaaagagtcgtgcatttttctctctcttaaaaatc |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35667573 |
accgatcatgttcaagcaaagagtcgtgcatttttctctctcttaaaaatc |
35667623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University