View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6986_low_22 (Length: 250)
Name: NF6986_low_22
Description: NF6986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6986_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 35667929 - 35668170
Alignment:
| Q |
1 |
taaatgtagatctagctagaaatctatctccagacgatagtgtattatttaaatatctctaacccttga---agggccttnnnnnnnnggtgcccgatga |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||| |||||||| ||| |
|
|
| T |
35667929 |
taaatgtagatctagctagaaatctatctccagacgatagtgtattatttaaatctctctaatccttgatttagggccttaaaagaaaggtgcccgttga |
35668028 |
T |
 |
| Q |
98 |
ggaattccttttcttcttgactttgaacgattaacgggaagcatactttctttgtctccgccttcttcttcctcctcctcgccctgattctcttcatttt |
197 |
Q |
| |
|
|| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35668029 |
ggtattccctttcttcttgaatttgaacgattaacgggaagcatactttctttgtctccgccttcttcttcctcctcctcgccctgattctcttcatttt |
35668128 |
T |
 |
| Q |
198 |
ctctatcaacttctgcttcttctagttttcgtttcagatttt |
239 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35668129 |
ctccatcaacttctgcttcttctagttttcgtttcagatttt |
35668170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 24930846 - 24930898
Alignment:
| Q |
187 |
ctcttcattttctctatcaacttctgcttcttctagttttcgtttcagatttt |
239 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
24930846 |
ctcttcattttcttcatcaattcctgcttcttcttgttttcgtttccgatttt |
24930898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 239
Target Start/End: Original strand, 25680352 - 25680404
Alignment:
| Q |
187 |
ctcttcattttctctatcaacttctgcttcttctagttttcgtttcagatttt |
239 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||| ||||||||||| |||||| |
|
|
| T |
25680352 |
ctcttcattttcttcatcaattcctgcttcttcttgttttcgtttccgatttt |
25680404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University