View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6986_low_23 (Length: 246)

Name: NF6986_low_23
Description: NF6986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6986_low_23
NF6986_low_23
[»] chr5 (1 HSPs)
chr5 (7-246)||(12634508-12634747)
[»] chr8 (2 HSPs)
chr8 (116-246)||(31151397-31151524)
chr8 (7-82)||(31151651-31151726)
[»] scaffold0599 (2 HSPs)
scaffold0599 (116-240)||(3044-3168)
scaffold0599 (12-77)||(2847-2912)
[»] scaffold0042 (2 HSPs)
scaffold0042 (116-240)||(11431-11555)
scaffold0042 (12-77)||(11687-11752)
[»] chr3 (2 HSPs)
chr3 (116-240)||(11911350-11911474)
chr3 (12-77)||(11911153-11911218)
[»] chr7 (2 HSPs)
chr7 (116-239)||(37960068-37960188)
chr7 (9-78)||(37959868-37959937)


Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 246
Target Start/End: Complemental strand, 12634747 - 12634508
Alignment:
7 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtgaattcacttactaacaaatgaaatt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12634747 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtgaattcacttactaacaaatgaaatt 12634648  T
107 actcaattctgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgg 206  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
12634647 actcaattctgataggatgccgtacatgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattataatgaatgg 12634548  T
207 gaagaagaaatccaaaggtaagagtaataaccacataaca 246  Q
    ||||||||||||||||||||||||||||||||||||||||    
12634547 gaagaagaaatccaaaggtaagagtaataaccacataaca 12634508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 116 - 246
Target Start/End: Complemental strand, 31151524 - 31151397
Alignment:
116 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 215  Q
    |||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||||||||||||||||||||  |||||||||   ||||    
31151524 tgataggatgccgtacgtgaacaatgatgtttatcttgagcttgcaaagttagattacaactattgtcaagcaatgcattatgatgaatggga---agaa 31151428  T
216 atccaaaggtaagagtaataaccacataaca 246  Q
    |||||||||||||| ||| ||||||||||||    
31151427 atccaaaggtaagaataaaaaccacataaca 31151397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 31151726 - 31151651
Alignment:
7 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtga 82  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
31151726 aatatggtggcgaaaatgatgtttggattggtaagaccctttacaggtaagaatcttaattttacattgaatgtga 31151651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0599 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: scaffold0599
Description:

Target: scaffold0599; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 240
Target Start/End: Original strand, 3044 - 3168
Alignment:
116 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 215  Q
    |||||||||||||||| ||| ||||||| |||| || |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
3044 tgataggatgccgtacatgaccaatgatgtttaacttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 3143  T
216 atccaaaggtaagagtaataaccac 240  Q
    ||||||||||||| ||| |||||||    
3144 atccaaaggtaagggtagtaaccac 3168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0599; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 77
Target Start/End: Original strand, 2847 - 2912
Alignment:
12 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
2847 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 2912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: scaffold0042
Description:

Target: scaffold0042; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 240
Target Start/End: Complemental strand, 11555 - 11431
Alignment:
116 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 215  Q
    |||||||||||||||| ||| ||||||| |||| || |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
11555 tgataggatgccgtacatgaccaatgatgtttatcttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 11456  T
216 atccaaaggtaagagtaataaccac 240  Q
    ||||||||||||| ||| |||||||    
11455 atccaaaggtaagggtagtaaccac 11431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 77
Target Start/End: Complemental strand, 11752 - 11687
Alignment:
12 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11752 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 11687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 240
Target Start/End: Original strand, 11911350 - 11911474
Alignment:
116 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 215  Q
    |||||||||||||||| ||  ||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
11911350 tgataggatgccgtacatggccaatgatgtttaccttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 11911449  T
216 atccaaaggtaagagtaataaccac 240  Q
    ||||||||||||| ||| |||||||    
11911450 atccaaaggtaagggtagtaaccac 11911474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 77
Target Start/End: Original strand, 11911153 - 11911218
Alignment:
12 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11911153 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 11911218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 116 - 239
Target Start/End: Original strand, 37960068 - 37960188
Alignment:
116 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 215  Q
    ||||||||||||||| |||||||||||| |||| || |||||||||| ||| ||||||||||||||||||||||||||||||  |||||||    |||||    
37960068 tgataggatgccgtatgtgaacaatgatgtttatcttgagcttgcaaggttggattacaacaattgtcaagcaatgcattatgatgaatgg---aaagaa 37960164  T
216 atccaaaggtaagagtaataacca 239  Q
    || || ||||||||||||||||||    
37960165 atacacaggtaagagtaataacca 37960188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 9 - 78
Target Start/End: Original strand, 37959868 - 37959937
Alignment:
9 tatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaat 78  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||    
37959868 tatggtggtgaaaatgatgtttggattggcaagaccctttataggtaagaatcttaattttacattgaat 37959937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University