View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6986_low_26 (Length: 239)
Name: NF6986_low_26
Description: NF6986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6986_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 30872577 - 30872356
Alignment:
| Q |
1 |
ctttagaaaatgatgatacggttgttaaggtaaatagggattttaaggtgaaattttcatcttcttcaagttgtggacaatctacggaatggaaagtggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30872577 |
ctttagaaaatgatgatacggttgttaaggtgaatagggattttaaggtgaaattttcatcttcttcaagttgtggacaatctacggaatggaaattggg |
30872478 |
T |
|
| Q |
101 |
tgatagggacaataggagtggaaggaggcttattatagcggggagtgatggtagtttatttagaattttgaagacttcatttggaattgaaggtgttata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30872477 |
tgatagggacaataggagtggaaggaggcttattatagcggggagtgatggtaattcatttagaattttgaagatttcatttggaattgaaggtgttata |
30872378 |
T |
|
| Q |
201 |
ggtaattataatattaggtttt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30872377 |
ggtaattataatattaggtttt |
30872356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 35 - 173
Target Start/End: Complemental strand, 30902780 - 30902642
Alignment:
| Q |
35 |
tagggattttaaggtgaaattttcatcttcttcaagttgtggacaatctacggaatggaaagtgggtgatagggacaataggagtggaaggaggcttatt |
134 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| |||||| || ||||||||| | |||||||| || | || ||||||||| ||| ||||| |
|
|
| T |
30902780 |
tagggattttaaggtgaaattttcagcttcttcaatttgtgtacaatccactgaatggaaattaggtgatagagatactaagagtggaagaagggttatt |
30902681 |
T |
|
| Q |
135 |
atagcggggagtgatggtagtttatttagaattttgaag |
173 |
Q |
| |
|
||||| || ||||||||||||| ||||||||| ||||| |
|
|
| T |
30902680 |
atagctggaagtgatggtagttattttagaattgtgaag |
30902642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University