View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6987_low_5 (Length: 228)
Name: NF6987_low_5
Description: NF6987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6987_low_5 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 5416246 - 5416343
Alignment:
| Q |
131 |
gcagattggtgaattagccggacttgcgattgggtctacaataataatagatatattgtttgcggggtattaactaatcttaaaacctaattgaatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416246 |
gcagattggtgaattagccggacttgcgattgggtctacaataataatagatatattgtttgcggggtattaactaatcttaaaacctaattgaatat |
5416343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 5416119 - 5416157
Alignment:
| Q |
7 |
cacatgccatgcgcatcaaaacatataataatccaaata |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5416119 |
cacatgccatgcgcatcaaaacatataataatccaaata |
5416157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University