View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6987_low_5 (Length: 228)

Name: NF6987_low_5
Description: NF6987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6987_low_5
NF6987_low_5
[»] chr2 (2 HSPs)
chr2 (131-228)||(5416246-5416343)
chr2 (7-45)||(5416119-5416157)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 131 - 228
Target Start/End: Original strand, 5416246 - 5416343
Alignment:
131 gcagattggtgaattagccggacttgcgattgggtctacaataataatagatatattgtttgcggggtattaactaatcttaaaacctaattgaatat 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5416246 gcagattggtgaattagccggacttgcgattgggtctacaataataatagatatattgtttgcggggtattaactaatcttaaaacctaattgaatat 5416343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 5416119 - 5416157
Alignment:
7 cacatgccatgcgcatcaaaacatataataatccaaata 45  Q
    |||||||||||||||||||||||||||||||||||||||    
5416119 cacatgccatgcgcatcaaaacatataataatccaaata 5416157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University