View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6988_high_13 (Length: 205)
Name: NF6988_high_13
Description: NF6988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6988_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 3824688 - 3824515
Alignment:
| Q |
18 |
tatttacgaagaaagaggcatcgttaatttagcatgtgaaagagaaactataatttatttttatcatattgtgatttattgtttttaaagagctatggcc |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3824688 |
tatttacgaagaaagaggcatggttaatttagcatgtgaaagagaaactataatttatttttatcatattgtgatttattgtttttaaagagctatggcc |
3824589 |
T |
|
| Q |
118 |
attggtaataataagacatgtaaagaacagacattgatccccacacaatctagtctaaaagatatgttctcttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
3824588 |
attggtaataataagacatgtaaagaacagacattgatccccacacaatcaagtccaaaagatatgttctcttt |
3824515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University