View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6990_low_2 (Length: 208)
Name: NF6990_low_2
Description: NF6990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6990_low_2 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 32143 - 31949
Alignment:
| Q |
1 |
gtttattccattgacnnnnnnnttaatgcataccaagttattgttactgttatgattctcagaggctttggaatcaacatggagagaggaacgagacaag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32143 |
gtttattccattgacaagaaaattaatgcataccaagttattgttattgttatgattctcagaggctttggaatcaacatggagagaggaacgagacaag |
32044 |
T |
 |
| Q |
101 |
caacgagttaactcagcgaagagttgttcatcatcgtcactttcggtttcgcttgaagcagcaagagaatcgatcggtgaactgagatcagagca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32043 |
caacgagttaactcagcgaagagttgttcatcatcgtcactttcggtttcgcttgaagcagcaagagaatcgatcggtgaactgagatcagagca |
31949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University