View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_high_19 (Length: 249)
Name: NF6991_high_19
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 22 - 236
Target Start/End: Complemental strand, 23280109 - 23279892
Alignment:
| Q |
22 |
ttcactgttctggttatgttcatgttgatttcgtttagttccatggtgctcatgtttcttgatttggttttagtatcatgtgattcnnnnnnnntcatca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23280109 |
ttcactgttctggttatgttcatgttgatttcgtttagttccatggtgctcttgtttcttgatttggttttagtatcttgtgattc-aaaaaaatcatca |
23280011 |
T |
 |
| Q |
122 |
agaatgcac----nnnnnnnnnnnaattcaaggagatcagcattggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgnnnnnnn |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23280010 |
agaatgcactttttttttttttttaattcaaggagatcagcattggtgtttgctttgtagattaagatatttagtgttgatggaagcatcatgttttttt |
23279911 |
T |
 |
| Q |
218 |
ggtatctcattattgatat |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23279910 |
ggtatctcattattgatat |
23279892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 195
Target Start/End: Original strand, 23400407 - 23400582
Alignment:
| Q |
22 |
ttcactgttctggttatgttcatgttgatttcgtttagttccatggtgctcatgtttcttgatttggttttagtatcatgtgattcnnnnnnnntcatca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| || |||||||| |||||| |
|
|
| T |
23400407 |
ttcactgttctggttatgttcatgttgatttcgtttagttccatggtgcacatgttccttgatttggttttagtttcttgtgattcaaaaaatttcatca |
23400506 |
T |
 |
| Q |
122 |
agaatgcac--nnnnnnnnnnnaattcaaggagatcagcattggtgtttgctttgtagattaagatatttagtgtt |
195 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23400507 |
agaatgcacttttctttttttcaattcaaggaaatcagcattggtgtttgctttgtagattaagatatttagtgtt |
23400582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 23400278 - 23400336
Alignment:
| Q |
22 |
ttcactgttctggttatgtt-catgttgatttcgtttagttccatggtgctcatgtttc |
79 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| | ||| ||||||||||||||| |
|
|
| T |
23400278 |
ttcactgttctgattatgtttcatgttgatttcgttaatttcagtggtgctcatgtttc |
23400336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University