View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_high_23 (Length: 231)
Name: NF6991_high_23
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 218
Target Start/End: Original strand, 12129603 - 12129815
Alignment:
| Q |
5 |
gcaacaaaggaagacatttttaattaactgtttagaaaattggctgaaaacaacattagtgagaggagaaagagggatggatagcatagtttcagaatct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12129603 |
gcaacaaaggaagacatttttaattaactgttcagaaaattggctgaaaacaacattagagagaggagaaagagggatggatagcatagtttcagaatct |
12129702 |
T |
 |
| Q |
105 |
aatcctggccacaaaattattggataggcctatctttttatgaaatgaaaaactatcagaaaatcttcttccaatttaatcttgaccacaaaagtatatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12129703 |
aatcctggccacaaaattattggataggcctatctttttatgaaatgaaaaactatcagaaaatcttcttccaatttaatcttgaccac-aaagtatatt |
12129801 |
T |
 |
| Q |
205 |
ctttggtccaaatt |
218 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
12129802 |
ctttggaccaaatt |
12129815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University