View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6991_high_23 (Length: 231)

Name: NF6991_high_23
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6991_high_23
NF6991_high_23
[»] chr8 (1 HSPs)
chr8 (5-218)||(12129603-12129815)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 218
Target Start/End: Original strand, 12129603 - 12129815
Alignment:
5 gcaacaaaggaagacatttttaattaactgtttagaaaattggctgaaaacaacattagtgagaggagaaagagggatggatagcatagtttcagaatct 104  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
12129603 gcaacaaaggaagacatttttaattaactgttcagaaaattggctgaaaacaacattagagagaggagaaagagggatggatagcatagtttcagaatct 12129702  T
105 aatcctggccacaaaattattggataggcctatctttttatgaaatgaaaaactatcagaaaatcttcttccaatttaatcttgaccacaaaagtatatt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
12129703 aatcctggccacaaaattattggataggcctatctttttatgaaatgaaaaactatcagaaaatcttcttccaatttaatcttgaccac-aaagtatatt 12129801  T
205 ctttggtccaaatt 218  Q
    |||||| |||||||    
12129802 ctttggaccaaatt 12129815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University