View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_high_25 (Length: 218)
Name: NF6991_high_25
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 5 - 134
Target Start/End: Complemental strand, 39232026 - 39231897
Alignment:
| Q |
5 |
aaaaattaatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacatagtcaattgaaatttgaaaggttgtattcattcattca |
104 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
39232026 |
aaaaaataatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacacagtcaattgaaatttgaaaggttgaattcattcattga |
39231927 |
T |
|
| Q |
105 |
acaaactacaattttcattgccgtcgaatg |
134 |
Q |
| |
|
||||| |||||||||||||||| ||||||| |
|
|
| T |
39231926 |
acaaattacaattttcattgccttcgaatg |
39231897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University