View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_high_9 (Length: 372)
Name: NF6991_high_9
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 34 - 363
Target Start/End: Original strand, 45461740 - 45462079
Alignment:
| Q |
34 |
tctataataaccatccatccaaaaataataaaattaattaagaagcaaaagtcgtacaaattaaagag----------aggggaagcaagatgaaaatga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45461740 |
tctataataaccatccatccaaaaataataaaattaattaagaagcaaaagtcgtacaaattaaagagcatgaaattgaggggaagcaagatgaaaatga |
45461839 |
T |
 |
| Q |
124 |
aatgagtaccgtttttgctgtggttgatacgggtagagagagcaagacatagacgcctgacagggaaaatcatagtttgccaaatatgcatgattttgtt |
223 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45461840 |
aatgagtaccgtttttgcggtggttgatacgggtagagagagcaagacatagacgcctgacagggaaaatcatagtttgccaaatatgcatgattttgtt |
45461939 |
T |
 |
| Q |
224 |
cttgtctttaacaactccttcacatagtactactgtcttcttcttccttttcttgttctttccatgcccttgcctatgtggcaacactactctctttgac |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45461940 |
cttgtctttaacaactccttcacatagtactactgtcttcttcttccttttcttgttctttccatgcccttgcctatgtggcaacactattctctttgac |
45462039 |
T |
 |
| Q |
324 |
caggccagtgccgctactctgattttcttcttcttcttct |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45462040 |
caggccagtgccgctactctgattttcttcttcttcttct |
45462079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University