View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_low_18 (Length: 275)
Name: NF6991_low_18
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 4 - 264
Target Start/End: Original strand, 10343903 - 10344163
Alignment:
| Q |
4 |
agtttggtggttgcgtcagtggtttgggttcactcagatcgcgctttcgcgacttggtccatgttgatcggtcatatgttttggtgatatttactattgg |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10343903 |
agtttggcggttgcgtcagtggtttgggttcactcagatcgcgctttcgcgacttggtccatgttgatcggtcatatgttttggtgatatatactattgg |
10344002 |
T |
|
| Q |
104 |
attttgagtcatgattttcactgttttgtctctgcctacactgtgtgccgcatcagaggatgtatttcagggagatctgggtctaggtctagttttgctg |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10344003 |
attttgagtcatgattttcactattttgtctctgcttgcactgtgtgccgcatcagaggatgtatttcagggagatctgggtctaggtctggttttgcta |
10344102 |
T |
|
| Q |
204 |
ctgggctcagattgtactgtcgaggcttggttctgttgttctataatgcgcttggtgatgt |
264 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10344103 |
ctgggctcagattgtactgtcgcggcttcgttctgttgttctataatgcgcttggtgatgt |
10344163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University