View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_low_26 (Length: 231)
Name: NF6991_low_26
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 3402937 - 3402755
Alignment:
| Q |
16 |
tgtttatagcgaacaacactatcgcgaattgatcacgaaattacaacaactgtaagatcttttctttggtggaataaatacgggcttaagttagttgcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3402937 |
tgtttatagcgaacaacactatcgcgaattgatcacgaaattacaacaactgtcagatcttttctttggtggaataaatacgggcttaagttagttgcat |
3402838 |
T |
 |
| Q |
116 |
agccatgatatcatcgtgaacttctttttcgctctaagtagcatttttgttctcttatatgattttgctgttcacatagcctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3402837 |
agccatgatatcatcgtgaacttctttttcgctctaagtagcatttttgttctcttatatgattttgttgttcacatagcctc |
3402755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 20829843 - 20829917
Alignment:
| Q |
16 |
tgtttatagcgaacaacactatcgcgaattgatcacgaaattacaacaactgtaagatcttttctttggtggaat |
90 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||| |||||||||| |||| | | |||||||||||||| |||| |
|
|
| T |
20829843 |
tgtttatagggaacaacactatcacaaattgatcgcgaaattacagcaaccatcatatcttttctttggttgaat |
20829917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 163
Target Start/End: Original strand, 20829971 - 20830015
Alignment:
| Q |
119 |
catgatatcatcgtgaacttctttttcgctctaagtagcattttt |
163 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
20829971 |
catgatatcattgtgagcttctttttcactctaagtagcattttt |
20830015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University