View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6991_low_27 (Length: 218)

Name: NF6991_low_27
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6991_low_27
NF6991_low_27
[»] chr4 (1 HSPs)
chr4 (5-134)||(39231897-39232026)


Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 5 - 134
Target Start/End: Complemental strand, 39232026 - 39231897
Alignment:
5 aaaaattaatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacatagtcaattgaaatttgaaaggttgtattcattcattca 104  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |    
39232026 aaaaaataatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacacagtcaattgaaatttgaaaggttgaattcattcattga 39231927  T
105 acaaactacaattttcattgccgtcgaatg 134  Q
    ||||| |||||||||||||||| |||||||    
39231926 acaaattacaattttcattgccttcgaatg 39231897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University