View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6991_low_28 (Length: 210)

Name: NF6991_low_28
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6991_low_28
NF6991_low_28
[»] chr7 (1 HSPs)
chr7 (38-189)||(1971850-1972002)
[»] chr8 (1 HSPs)
chr8 (38-189)||(19962826-19962978)
[»] chr1 (1 HSPs)
chr1 (129-189)||(4326995-4327055)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 38 - 189
Target Start/End: Original strand, 1971850 - 1972002
Alignment:
38 tggttcaagcaaattaggggcatttgattgctagggctttttcaaaa-attgtatgggtgcatgagattcattcaagtctgttttgaagttgtttcaatg 136  Q
    |||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||| |||||||||||     
1971850 tggttcaagcaaattaggggcatttgattgctagggcttttttaaaaaattgtatgggtgaatgagattcattcaagtctgttttgaggttgtttcaata 1971949  T
137 tttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat 189  Q
    ||||| |||||| ||||||||||||||||||||||||||| ||||||||||||    
1971950 tttgaatgcaacaccaacctgatatgttatctctttggtgtaatggtaggaat 1972002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 38 - 189
Target Start/End: Original strand, 19962826 - 19962978
Alignment:
38 tggttcaagcaaattaggggcatttgattgctagggctttttcaaaa-attgtatgggtgcatgagattcattcaagtctgttttgaagttgtttcaatg 136  Q
    |||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| | |||||||||     
19962826 tggttcaagcaaattaggggaatttgattgctagggctttttcaaaaaattgtatgggtgcatgagattcattcaagtctgtgttgacgctgtttcaata 19962925  T
137 tttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat 189  Q
    |||||| ||||||| |||   ||| |||||||||||||| |||||||||||||    
19962926 tttgaccgcaactctaacacaatacgttatctctttggtaaaatggtaggaat 19962978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 4327055 - 4326995
Alignment:
129 tttcaatgtttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat 189  Q
    |||||||  ||||| |||||||||||| |||| ||| |||||||||| |||||||| ||||    
4327055 tttcaatccttgacagcaactccaacccgatacgttttctctttggtaaaatggtatgaat 4326995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University