View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_low_28 (Length: 210)
Name: NF6991_low_28
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 38 - 189
Target Start/End: Original strand, 1971850 - 1972002
Alignment:
| Q |
38 |
tggttcaagcaaattaggggcatttgattgctagggctttttcaaaa-attgtatgggtgcatgagattcattcaagtctgttttgaagttgtttcaatg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1971850 |
tggttcaagcaaattaggggcatttgattgctagggcttttttaaaaaattgtatgggtgaatgagattcattcaagtctgttttgaggttgtttcaata |
1971949 |
T |
 |
| Q |
137 |
tttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat |
189 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1971950 |
tttgaatgcaacaccaacctgatatgttatctctttggtgtaatggtaggaat |
1972002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 38 - 189
Target Start/End: Original strand, 19962826 - 19962978
Alignment:
| Q |
38 |
tggttcaagcaaattaggggcatttgattgctagggctttttcaaaa-attgtatgggtgcatgagattcattcaagtctgttttgaagttgtttcaatg |
136 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
19962826 |
tggttcaagcaaattaggggaatttgattgctagggctttttcaaaaaattgtatgggtgcatgagattcattcaagtctgtgttgacgctgtttcaata |
19962925 |
T |
 |
| Q |
137 |
tttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat |
189 |
Q |
| |
|
|||||| ||||||| ||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
19962926 |
tttgaccgcaactctaacacaatacgttatctctttggtaaaatggtaggaat |
19962978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 189
Target Start/End: Complemental strand, 4327055 - 4326995
Alignment:
| Q |
129 |
tttcaatgtttgactgcaactccaacctgatatgttatctctttggtgaaatggtaggaat |
189 |
Q |
| |
|
||||||| ||||| |||||||||||| |||| ||| |||||||||| |||||||| |||| |
|
|
| T |
4327055 |
tttcaatccttgacagcaactccaacccgatacgttttctctttggtaaaatggtatgaat |
4326995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University