View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6991_low_3 (Length: 420)
Name: NF6991_low_3
Description: NF6991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6991_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 314 - 409
Target Start/End: Original strand, 39952493 - 39952588
Alignment:
| Q |
314 |
ctatgtgctgccttgtaaaaatcgaagaggcggtgtcagtgtaaaagtcggttcatgcatttgtcccttcatgttaattcgatgtttttggttctt |
409 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952493 |
ctatgtgctgtcttgtaaaaatcgaagaggcggtgtcagtgtaaaagtcggttcatgcatttgtcccttcatgttaattcgatgtttttggttctt |
39952588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 114 - 228
Target Start/End: Original strand, 39952289 - 39952403
Alignment:
| Q |
114 |
attcatagcttaacattgcaaagatcgtatcnnnnnnnnnnnnncttcatgttagtaccattcttgaagtttttatttaactgggtcaacgttttaaatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952289 |
attcatagcttaacattgcaaagatcgtatcttttttactttttcttcatgttagtaccattcttgaagtttttatttaactgggtcaacgttttaaatc |
39952388 |
T |
|
| Q |
214 |
aaaaatatagaaaaa |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39952389 |
aaaaatatagaaaaa |
39952403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 14 - 88
Target Start/End: Original strand, 9546180 - 9546254
Alignment:
| Q |
14 |
tgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcctcgtaccttcttcaacggtttcagttct |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546180 |
tgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcctcgtaccttcttcaacggtttcagttct |
9546254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University