View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6992_high_3 (Length: 326)
Name: NF6992_high_3
Description: NF6992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6992_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 47287047 - 47286729
Alignment:
| Q |
1 |
tcatcaccatcaccatctccattacaatcattattatcatcaccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagcta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47287047 |
tcatcaccatcaccatctccattaccatcattattatcatcaccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagcta |
47286948 |
T |
 |
| Q |
101 |
tgcacatgcaactttcacacaacaataaaatcataattttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286947 |
tgcacatgcaactttcacacaacaataaaatcataattttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatgga |
47286848 |
T |
 |
| Q |
201 |
tccattcgacactgcccttaaaattgattgcactgctcactctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286847 |
tccattcgacactgcccttaaaattgattgcactgctcactctgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacact |
47286748 |
T |
 |
| Q |
301 |
tggtgttccacaggttctg |
319 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
47286747 |
tggtgttcctcaggttctg |
47286729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University