View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6992_low_9 (Length: 231)
Name: NF6992_low_9
Description: NF6992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6992_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 17919721 - 17919524
Alignment:
| Q |
18 |
tgcagctaaaaatggggtaaagatcacgatccttaggtttggatgataacaaagctaatttaattcggaaacatgacgttcaaagatgcggagacaaacc |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
17919721 |
tgcagctaaaaatgggttaaagatcacgatccttaggtttggatgataacaaagctaatttaattcagaaacatgacgttcaaagatgccgagacaaacc |
17919622 |
T |
 |
| Q |
118 |
tttctattgccttgaaaacttgtgtcacaaattgaatagcatgccatttaacatgctcttctattcgtttgtcgtaactattttcatcatcatgaaac |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17919621 |
tttctattgccttgaaaacttgcgtcacaaattgaagagcatgccgtttaacatgctcttctatttgtttgtcgtaactattttcatcatcatgaaac |
17919524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University