View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6993_high_23 (Length: 332)

Name: NF6993_high_23
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6993_high_23
NF6993_high_23
[»] chr6 (1 HSPs)
chr6 (113-316)||(16281228-16281431)


Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 113 - 316
Target Start/End: Original strand, 16281228 - 16281431
Alignment:
113 gcggttctccctcaccgaatcagcgtcgaagagaacgatctaacggttttgaatccagatcgtgattcctccgttgccgaatttcgaaattgcgaggagg 212  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16281228 gcggttctccctcaccaaatcagcgtcgaagagaacgatctaacggttttgaatccagatcgtgattcctccgttgccgaatttcgaaattgcgaggagg 16281327  T
213 ttcgttacggtttttagtttacgttttgtgaagagttaatgtgcttagatattcgtgtagattttttagttgattttcgttggttactgttagcatttca 312  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
16281328 ttcgttacggtttttagtttacgttttgtgaagagttaatgtgctttgatattcgtttagattttttagttgattttcgttggttactgttagcatttca 16281427  T
313 tttt 316  Q
    ||||    
16281428 tttt 16281431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University