View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_high_23 (Length: 332)
Name: NF6993_high_23
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 113 - 316
Target Start/End: Original strand, 16281228 - 16281431
Alignment:
| Q |
113 |
gcggttctccctcaccgaatcagcgtcgaagagaacgatctaacggttttgaatccagatcgtgattcctccgttgccgaatttcgaaattgcgaggagg |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16281228 |
gcggttctccctcaccaaatcagcgtcgaagagaacgatctaacggttttgaatccagatcgtgattcctccgttgccgaatttcgaaattgcgaggagg |
16281327 |
T |
 |
| Q |
213 |
ttcgttacggtttttagtttacgttttgtgaagagttaatgtgcttagatattcgtgtagattttttagttgattttcgttggttactgttagcatttca |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16281328 |
ttcgttacggtttttagtttacgttttgtgaagagttaatgtgctttgatattcgtttagattttttagttgattttcgttggttactgttagcatttca |
16281427 |
T |
 |
| Q |
313 |
tttt |
316 |
Q |
| |
|
|||| |
|
|
| T |
16281428 |
tttt |
16281431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University