View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_high_27 (Length: 321)
Name: NF6993_high_27
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 306
Target Start/End: Complemental strand, 14566755 - 14566466
Alignment:
| Q |
17 |
ctttgtaatgatatcttggcttcatcttgtattgcaaatttgtcaactttctctttgcgttaccgttattatatgccacctcacttatatcttttttctg |
116 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14566755 |
ctttgtaatgatatcttgtcttcatcttgtattgcaaatttgtcgactttgtctttgcgttaccgttattatatgccacctcacttatatcttttttctg |
14566656 |
T |
 |
| Q |
117 |
tttgtaataaaccaggtttggtgaagtcactgaatggtgcaatatgccaacagtaaaagtagctgtgacagttgatgctcctagagttgtgaaattggtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14566655 |
tttgtaataaaccaggtttggtgaagtcactgaatggtgcaatatgccaacagtaaaagtagctgtgacagttgatgctcctagagttgtgaaattggtc |
14566556 |
T |
 |
| Q |
217 |
ttggatcatcttttggattgatcgtaatacgaagttgttcaacaagaattattgattcatgtctgtttagaaacatgataccacttacca |
306 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14566555 |
ttggatcgtcttttggattgatcgtaatacgaagttgttcaacaagaattattgattcatgtctgttgagaaacatgataccacttacca |
14566466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 105 - 237
Target Start/End: Complemental strand, 14572825 - 14572693
Alignment:
| Q |
105 |
atcttttttctgtttgtaataaaccaggtttggtgaagtcactgaatggtgcaatatgccaacagtaaaagtagctgtgacagttgatgctcctagagtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
14572825 |
atcttttttctgtttgtaataaaccaggtttggcgaaaccactgaatggtgcaatatgccaacagtaaaagtagctgtgacagtagatgctccgagagtt |
14572726 |
T |
 |
| Q |
205 |
gtgaaattggtcttggatcatcttttggattga |
237 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||| |
|
|
| T |
14572725 |
gtgaaattggtcatggatcgtcttttggtttga |
14572693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University