View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_high_6 (Length: 620)
Name: NF6993_high_6
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 337
Target Start/End: Original strand, 26450429 - 26450752
Alignment:
| Q |
17 |
attatgtgtggttgggtgaagaaattgattatggaaaaacatggtgttggtgatgttgttgatcttcttgttgatatggattgtgttggtttgagacctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26450429 |
attatgtgtggttgggtgaagaaattgattatggaaaaacatggtgttggtgatgttgttgatcttcttgttgatatggattgtgttggtttgagacctg |
26450528 |
T |
|
| Q |
117 |
gtttcagtatgattgagaaggttatttctttgtattgggatatgggggagaaagatggtgcttgtttgtttgtgcaagaggttttgagacgtgggattgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26450529 |
gtttcagtatgattgagaaggttatttctttgtattgggatatgggggagaaagatggtgcttgtttgtttgtgcaagaggttttgagacgtgggattgc |
26450628 |
T |
|
| Q |
217 |
ttgtaatgaggatgatcctgaagggcataagggtggaccaactggatatcttgcttggaagatgatggtaagatttccataattga---ctaagtttttt |
313 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
26450629 |
ttgtaatgaggatgatcctgatgggcataagggtggaccaactggatatcttgcttggaagatgatggtaagactttcataattgatatctaagtttttt |
26450728 |
T |
|
| Q |
314 |
gttatttggttggagaattagttc |
337 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26450729 |
gttatttggttggagaattagttc |
26450752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 158; E-Value: 9e-84
Query Start/End: Original strand, 402 - 599
Target Start/End: Original strand, 26450817 - 26451013
Alignment:
| Q |
402 |
tcatttggtttccttcactttgcatgtgtttggttctgcggtgccaaagttgattatactataatttgttttgattaaaagttagtttaacataaggtca |
501 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||| | || |
|
|
| T |
26450817 |
tcatttggtttccttcactttgcatgtgtttggttctgcggtgccaaagttgaatatactataattggttttgattaaaagttagtttaccataacg-ca |
26450915 |
T |
|
| Q |
502 |
tttatgtatggataatttatgagaaaactgttctttatcaattcattgcaatcggggaaccaaacacgggcatcgatgttttgttaattggaatcgtg |
599 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
26450916 |
tttatgtatggataatttatgagaaaagtgttctttatcaattcattgcaatcgcggaaccaaacacggtcatcgatgttttgttaattggagtcgtg |
26451013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University