View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_12 (Length: 493)
Name: NF6993_low_12
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 426; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 426; E-Value: 0
Query Start/End: Original strand, 19 - 480
Target Start/End: Complemental strand, 29295666 - 29295205
Alignment:
| Q |
19 |
agatcaagggaattttgatgctgtgttttcggatttattgaagtttgcttactcgcagaaggaagatttgcaggagttaacgtttaatgcgtctttgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29295666 |
agatcaagggaattttgatgctgtgtattcggatttattgaagtttgcttactcgcagaaggaagatttgcaggagttaacgtttaatgcgtcgttgaca |
29295567 |
T |
 |
| Q |
119 |
gttatgaaaatgtcgaaggatttagagaaaactgaagtttgtgattctttgttaccgattttgctgggttttatcgatcttcaagatggagaagacgagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29295566 |
gttatgaaaatgtcgaaggatttagagagaactgaagtttgtgattctttgttaccgattttgctgggttttatcgatcttcaagatggagaagacaagg |
29295467 |
T |
 |
| Q |
219 |
attttccggatatgcttaagcaattagagaatttggtaacgctggatatcgaaacactttttgatggtaaagaaggtgatgtgttttggtgtatgattcg |
318 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295466 |
atttgccggatatgcttaagcaattagagaatttggtaacgctggatatcgaaacaattttttatggtaaagaaggtgatgtgttttggtgtatgattcg |
29295367 |
T |
 |
| Q |
319 |
tgtcgcggagatggaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtg |
418 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29295366 |
tgtggcggagatggaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtg |
29295267 |
T |
 |
| Q |
419 |
gtaaagaaattttctccggaggaagtgaagagagtattttctgttattatagctatgatgtc |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29295266 |
gtaaagaaattttctccggaggaagtgaagagagtattttctgttattatagatatgatgtc |
29295205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University