View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_20 (Length: 387)
Name: NF6993_low_20
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 378
Target Start/End: Original strand, 42667196 - 42667554
Alignment:
| Q |
19 |
tctcttaaccctcaagccatggcttctcttcaacaagcacaggtttcatcgaattttctatgtgtaatttgataacctaannnnnnnnnnnnnnnngttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42667196 |
tctcttaaccctcaagccatggcttctcttcaacaagcacaggtttcatcgaattttctatgtgtaatttgataacctaattgtttttaattttt-gttg |
42667294 |
T |
|
| Q |
119 |
aatttgaaaagttagggttggttgtttatgatattgtaggctcttgctggaggtcctttgattcaggctcggaattttgctgttatgactggagtgagtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
42667295 |
aatttgaaaagttagggttggttgtttatgatattgtaggctcttgctggaggtccattgattcaggctcggaattttgctattttgactggtgtgagtg |
42667394 |
T |
|
| Q |
219 |
ctggtattacttgtgttttgagaaggttgagaggaaaggaagatgttaaatctaggtgaaatttcttgagtcaatttttgcataaattaactactcttgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667395 |
ctggtattacttgtgttttgagaaggttgagaggaaaggaagatgttaaatctaggtgaaatttcttgagtcaatttttgcataaattaactactcttgt |
42667494 |
T |
|
| Q |
319 |
gggtgaaattatacatatttttctgttcatatagctgtgtccaattattaacacgaaact |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42667495 |
gggtgaaattatacatatttttctgttcatatagctgtgtccaattattaacactaaact |
42667554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University