View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_21 (Length: 386)
Name: NF6993_low_21
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 29 - 372
Target Start/End: Original strand, 43634074 - 43634417
Alignment:
| Q |
29 |
gtggatcaaacgaagtcttgaatcatcttttctttaattgtgcacttttcaccaatatttggtttgaaaattttaaatggttagacacttgttgtgtttt |
128 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43634074 |
gtggatcaaacaaagtcttgaatcatcttttctttaattgtgcatttttcgccaatatttggtttgcaaattttaaatggttagacacttgttgtgtttt |
43634173 |
T |
|
| Q |
129 |
gccaaacaatgcatatgaacaatatttggtttgtgagtatatggttgttgttgaaggagcgcaatcaaaggtcaaaattccattttggtagtgactcaga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
43634174 |
gccaaacaatgcatatgaacaatatttggtttgtgagtatatggttgttgttgaaggagcgcaatcaaaggtcaaaattccattttggcagtgactcata |
43634273 |
T |
|
| Q |
229 |
gctaagccgtccgatttcgattatccattaatttatcgtcagataagttannnnnnnacgccttctatcatgcccaatgttgaagttgcatgtgttttta |
328 |
Q |
| |
|
| ||| ||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43634274 |
gataaaccgtccgatttcgattatccactaatttattgtcagataagttatttttttacgccttctatcatgcccaatgttgaagttgcatgtgttttta |
43634373 |
T |
|
| Q |
329 |
attcttcttgcttgcgggggtgttggttgttgtcatgttgatgt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43634374 |
attcttcttgcttgcgggggtgttggttgttgtcatgttgatgt |
43634417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University