View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_22 (Length: 372)
Name: NF6993_low_22
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 214 - 367
Target Start/End: Complemental strand, 48287355 - 48287203
Alignment:
| Q |
214 |
tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatagnnnnnnnnnnnnngt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48287355 |
tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatag-ttttttatttttgt |
48287257 |
T |
 |
| Q |
314 |
ttgatattaacattttaaggttgaaatttggatagtctgatcttgcagattgtc |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48287256 |
ttgatattaacattttaaggttgaaatttggatagtctgatcttgcagattgtc |
48287203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 48287441 - 48287353
Alignment:
| Q |
18 |
aggtcatccaaaaacaaatgataataaaccaagcaaatttcaaagctacattataggtaaaacgtagtgtatgtctgaattggtggttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48287441 |
aggtcatccaaaaacaaatgataataaaccaagcaaatttcaaagctacattataggtaaaacgtagtgtatgtctgaattggtggttt |
48287353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University