View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_25 (Length: 346)
Name: NF6993_low_25
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 13 - 328
Target Start/End: Original strand, 41547661 - 41547976
Alignment:
| Q |
13 |
atggacatcataagaaacaaggtatcaaaacccttgcaactaatttctctgtatttattttaactactcaaatcgtaatcattgtacagtttctcttgta |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41547661 |
atggaaatcataagaaacaaggtatcaaaacccttgcaactaatttctctgtatttattttaactactcaaatcgtaatcattgtacattttctcttgta |
41547760 |
T |
|
| Q |
113 |
acactttttataccatatgatgcagaaagtgaccatgttgaagaagttttatgtgatatatagttttttctttgttcggaagatcatagcccatgtggtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547761 |
acactttttataccatatgatgcagaaagtgaccatgttgaagaagttttatgtgatatatagttttttctttgttcggaagatcatagcccatgtggtc |
41547860 |
T |
|
| Q |
213 |
acatttacattttactgcgtcattttgcctgcaactgttttagttccagaagtagaagttcccaagtggggtgctgtctatataccttgtattattacac |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547861 |
acatttacattttactgtgtcattttgcctgcaactgttttagttccagaagtagaagttcccaagtggggtgctgtctatataccttgtattattacac |
41547960 |
T |
|
| Q |
313 |
tcctcaatgctgttgg |
328 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41547961 |
tcctcaatgctgttgg |
41547976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University