View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_32 (Length: 325)
Name: NF6993_low_32
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 216 - 324
Target Start/End: Original strand, 7917236 - 7917340
Alignment:
| Q |
216 |
tacccaaaacttttacggttgtagcattatacattcttattactgaacttcaatttaccacgattgtaacttccacctcctttatttttagtccattcaa |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| | |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7917236 |
tacccaaaacttttacggttgtagcattatacattcttattact----ttcactttaccatgcttgtaacttccacctcctttatttatagtcaattcaa |
7917331 |
T |
 |
| Q |
316 |
catgattct |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
7917332 |
catgattct |
7917340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 7907809 - 7907890
Alignment:
| Q |
19 |
actcttagttccttgtcatgtgattggagcatcctat--gtctaggtactaaaaattggatttgtcactttcctatgtagta |
98 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907809 |
actctttgttccttgtcatgtgattggagcatcctatatgtctaggtactaaaaattggatttgtcactttcctatgtagta |
7907890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University