View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_44 (Length: 293)
Name: NF6993_low_44
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 86 - 242
Target Start/End: Original strand, 41105173 - 41105328
Alignment:
| Q |
86 |
tttcgtgggggtggtactctagattaaactttgcaagataagtttgaggacttgagggggaggaggcagtgtcctgctttcttttccagtggccactttg |
185 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||| | ||||||||||||||||||||||| || |||| |||| ||||||||||||| |||||||||| |
|
|
| T |
41105173 |
tttcgtgggggcggtgctctagattcaactttggaggataagtttgaggacttgagggg-agcgggcactgtcttgctttcttttccctcggccactttg |
41105271 |
T |
|
| Q |
186 |
tcataaagctttgcagcccttggatctgttagcagcttcttctgaaaggactgcgaa |
242 |
Q |
| |
|
||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41105272 |
tcaagaagctttgctgcccttggatctgttagcagcttcttctgaaaagactgcgaa |
41105328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 129
Target Start/End: Original strand, 41082299 - 41082412
Alignment:
| Q |
16 |
caaactgatatatccatttcataaacaaagattgaaaagggaaaaggaactatgtaactnnnnnnngagatttcgtgggggtggtactctagattaaact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
41082299 |
caaactgatatatccatttcataaacaaagatcgaaaagggaaaaggaactatgtaactaaaaaaaaaaaattcgtgggggtggtactctagattaaact |
41082398 |
T |
|
| Q |
116 |
ttgcaagataagtt |
129 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
41082399 |
ttgcaaggtaagtt |
41082412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 21865268 - 21865315
Alignment:
| Q |
191 |
aagctttgcagcccttggatctgttagcagcttcttctgaaaggactg |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||| || |||||||| |
|
|
| T |
21865268 |
aagctttgcagcccttggatctgttagtagcatcttttggaaggactg |
21865315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University