View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_54 (Length: 247)
Name: NF6993_low_54
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 20 - 128
Target Start/End: Complemental strand, 308299 - 308191
Alignment:
| Q |
20 |
cacagacttgaattcccttatagtagcagacacaagtgcactcaatgaaataaaacattaatttcactacatataatattttagaattatcaaacatcca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
308299 |
cacagacttgaattcccttatagtagcagacacaagtgcactcaatgaaataaaacattaatttcactacatataatattttagaattatcaaacatcca |
308200 |
T |
|
| Q |
120 |
acaccaatg |
128 |
Q |
| |
|
||||||||| |
|
|
| T |
308199 |
acaccaatg |
308191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University