View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6993_low_60 (Length: 235)
Name: NF6993_low_60
Description: NF6993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6993_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 39834693 - 39834493
Alignment:
| Q |
15 |
caagcaacatagtatatccgagcctgcaatgccactcctcccctcccactcaaggaatcaaagctgacttgtcatcttagcatcaataatattaattgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39834693 |
caagcaacatagtatatccgagcctgcaatgccactcctcccctcccactcaaggaatcaaagctgacttgtcatcttagcatcaataatattagttgat |
39834594 |
T |
|
| Q |
115 |
gatttatttaaatcttaagatagcaattaacacctttagttaaccatgaagcccacttaagtcattttataattgtattaacatgatccacttcttctgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39834593 |
gatttatttaaatcttaagatagcaattaacacctttagttaaccatgaagcccacttaagtcattttataattgtattaacacgatccacttcttctgt |
39834494 |
T |
|
| Q |
215 |
g |
215 |
Q |
| |
|
| |
|
|
| T |
39834493 |
g |
39834493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 71 - 197
Target Start/End: Complemental strand, 39824314 - 39824186
Alignment:
| Q |
71 |
atcaaagctgacttgtcatcttagcatcaataatattaattgatgatttatttaaatcttaagatagcaattaacacctttagttaacc---atgaagcc |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| | | ||| || ||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
39824314 |
atcaaagctgacttgtcatcttagcatcaataatattaattaatgatttctat-aatgttgggatagcaattagcacctttaattaaccatgatgaagcc |
39824216 |
T |
|
| Q |
168 |
cacttaagtcattttataattgtattaaca |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
39824215 |
cacttcagtcattttataattgtattaaca |
39824186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University