View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6994_low_1 (Length: 450)
Name: NF6994_low_1
Description: NF6994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6994_low_1 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 117 - 441
Target Start/End: Original strand, 76926 - 77233
Alignment:
| Q |
117 |
taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatactaaatcagcaaacaaattaaaaatgcaacatgatcttgaaggtgaaagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
76926 |
taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatacaaaa-----------------aatgcaacatgatcttgaaggtgaaagt |
77008 |
T |
 |
| Q |
217 |
cctcgatcaagttaatctcgttaggaaatatcggtagcgatggccaaaattgaccgatctaaataaagttaatgctaatgtgattgaagattttcaattt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
77009 |
cctcgatcaagttaatctcgttaggaaacatcggtagcgatggccaaaattgaccgatctaaataaagttaatgctaatgtgattgaaggttttcaattt |
77108 |
T |
 |
| Q |
317 |
attgactgttttcaaattttgttaattataagatcgaattcacataaatgttttgtgaacacatttttgacatcaacaacttatatactgatttttatgt |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
77109 |
attgactgttttcaaattttgttaattataagatcgaattcacataaatgttttgtgaacacattttcgacatcaacaacttatatactgatttttttgt |
77208 |
T |
 |
| Q |
417 |
tatttttcctttcttcggttcttct |
441 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
77209 |
tgtttttcctttcttcggttcttct |
77233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 20 - 63
Target Start/End: Original strand, 76829 - 76872
Alignment:
| Q |
20 |
cccatatagctcatgatcgttactgtgagactctgcaattccac |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76829 |
cccatatagctcatgatcgttactgtgagactctgcaattccac |
76872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University