View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6995_high_19 (Length: 236)
Name: NF6995_high_19
Description: NF6995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6995_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 90 - 231
Target Start/End: Complemental strand, 45445519 - 45445378
Alignment:
| Q |
90 |
ggtgacgagggtgattggaatgtggagcacactcacttaagtatttttaaacttgttcatacattttagtccaatggatgatattaactcctctcatata |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445519 |
ggtgacgagggtgattggaatgtggagcacactcacttaagtatttttaaacttgttcatacattttagtccaatggatgatattaactcctctcatata |
45445420 |
T |
 |
| Q |
190 |
aatatatatcttttgacattagctgtgtcgtgtctgatgtcc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45445419 |
aatatatatcttttgacattagctgtgtcgtgtctggtgtcc |
45445378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 45445686 - 45445597
Alignment:
| Q |
1 |
taattgatccaatgattgttcctttgcctcttggagcttctttatcatgtgtaaatcgtgcagctaacaatataaggagtgtgtgaatcg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445686 |
taattgatccaatgattgttcctttgcctcttggagcttctttatcatgtgtaaatcgtgcagctaacaatataaggagtgtgtgaatcg |
45445597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University