View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6995_low_11 (Length: 426)
Name: NF6995_low_11
Description: NF6995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6995_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 5e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 320 - 419
Target Start/End: Complemental strand, 16008095 - 16007993
Alignment:
| Q |
320 |
taaaattattttctagaacttattcagtgatatttgattgaaattattgta--nnnnnnnnccg-aaaaaatagagcgtgagtattttgaattttttctt |
416 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16008095 |
taaaattattttctagaacttattaagtgatatttgattgaaattattgtattttttttttccgaaaaaaatagagcgtgagtattttgaattttttctt |
16007996 |
T |
|
| Q |
417 |
ctc |
419 |
Q |
| |
|
||| |
|
|
| T |
16007995 |
ctc |
16007993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University