View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6995_low_22 (Length: 259)

Name: NF6995_low_22
Description: NF6995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6995_low_22
NF6995_low_22
[»] chr2 (2 HSPs)
chr2 (141-259)||(35701208-35701323)
chr2 (16-88)||(35701377-35701449)


Alignment Details
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 141 - 259
Target Start/End: Complemental strand, 35701323 - 35701208
Alignment:
141 actaatcgtacatatacatgtcaatagnnnnnnnnnnggagagatatacatgccaatagttaattaacaaacttaccctttgatatatattttttctaac 240  Q
    |||||||||||||||||||||||||||          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
35701323 actaatcgtacatatacatgtcaatagttttttt---ggagagatatacatgccaatagttaattaacaaacttaccctttgatatatattttttctaaa 35701227  T
241 aaatacccttttgatatat 259  Q
    |||||||||||||||||||    
35701226 aaatacccttttgatatat 35701208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 16 - 88
Target Start/End: Complemental strand, 35701449 - 35701377
Alignment:
16 tttggtgttgtactagttttgtaattgacattgtgtactcttgtgttctatcaatacacttctggtgttaagt 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
35701449 tttggtgttgtactagttttgtaattgacattgtgtactcttgtgttctatcaatacacttctagtgttaagt 35701377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University