View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6997_low_6 (Length: 333)
Name: NF6997_low_6
Description: NF6997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6997_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 10 - 325
Target Start/End: Complemental strand, 38080074 - 38079759
Alignment:
| Q |
10 |
catcatcaatcaagaggaatccttggctcgagaactttttccagattattgccccccgttatcctctggtggaggtactggttctatggtcatcaacgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38080074 |
catcatcaatcaagaggaatccttggctcgagaactttttccagattattgccccccgttatcctctggtggaggtactggttctatggtcatcaacgat |
38079975 |
T |
|
| Q |
110 |
tgcagtgagtatgatgttgatggggctgacggcgagtcaaactttgatgtggaggaccgaaaacccgagaatcttcatccatccaatcttgggatggata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079974 |
tgcagtgagtatgatgttgatggggctgacggcgagtcaaactttgatgtggaggaccgaaaacccgagaatcttcatccatccaatcttgggatggata |
38079875 |
T |
|
| Q |
210 |
gaatgaggggaagctttccagttcagcaaccttctcatcaaatcaagggagaggttgtcacaaacttggatttcattcggaagaggaagatctctaacga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38079874 |
gaatgaggggaagctttccagttcagcaaccttctcatcaaatcaagggagaggttgtcacaaacttggatttcattcggaagaggaagatctctaacga |
38079775 |
T |
|
| Q |
310 |
cttcaacatgatgatg |
325 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38079774 |
cttcaacatgatgatg |
38079759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University