View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6997_low_7 (Length: 326)
Name: NF6997_low_7
Description: NF6997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6997_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 28988043 - 28988356
Alignment:
| Q |
1 |
ttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtatccaaaacgcaccggtgtctgacactgacacaacacctacacata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28988043 |
ttgttactagtaagttctgaagcacggacacctcttagattaggtgtttcctgtgtccaaaacgcaccggtgtctgacactgacacaacacctacacata |
28988142 |
T |
|
| Q |
101 |
aatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtctaagttagaattttggagctttaaataattgtagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28988143 |
aatcacctgtgtcgacgtatccgtgtcagtgtcgtgtcggtgtctgcttcgtagctagtaaagtataagttagaattttggagctttaaataattgtagt |
28988242 |
T |
|
| Q |
201 |
gtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtacattgattatgttaatgatgcttccgggttctgattttgagccctgttat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28988243 |
gtggtgggggaaaaataccttttcttctttcttttctctgaggttgtgtac---gattatgttaatgatgcttctgggttctgattttgagccctgttat |
28988339 |
T |
|
| Q |
301 |
tttgtggctgatgatgt |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28988340 |
tttgtggctgatgatgt |
28988356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 138
Target Start/End: Original strand, 44572654 - 44572683
Alignment:
| Q |
109 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44572654 |
gtgtcgacgtatccgtgtcagtgtcgtgtc |
44572683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University