View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6997_low_8 (Length: 312)
Name: NF6997_low_8
Description: NF6997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6997_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 306
Target Start/End: Original strand, 39076154 - 39076443
Alignment:
| Q |
9 |
acatcatcaccatcattttcaatttcatcatttatctaagaccaattgcagccgcagnnnnnnnnnnnnnnnnnngcatttatgaaaaagtaaaacaagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39076154 |
acatcatcaccatcattttcaatttcatcatttatctaagaccaattgcagccgcagttttttttt---------gcatttatgaaaaagtaaaacaagt |
39076244 |
T |
 |
| Q |
109 |
gcaggttgaacaaaaagcttttt-gattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacattaattgcttaactatataagtcttc |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076245 |
gcaggttgaacaaaaagctttttcgattgcacgaacaaatatgaatttgtcttaacaagctaaatgcatggacattaattgcttaactatataagtcttc |
39076344 |
T |
 |
| Q |
208 |
attcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaatacaaattagtgcaagtaaatgtttagacaatgcaatgatgatgtc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076345 |
attcagtgttttcttcgcataattgttgagctgcatatacttagtcaattaaaaacaaattagtgcaagtaaatgtttagacaatgcaatgatgatgtc |
39076443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University