View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6999_high_9 (Length: 229)
Name: NF6999_high_9
Description: NF6999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6999_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 12383205 - 12383000
Alignment:
| Q |
1 |
tcatggaaatcacaggcaacggaattgcccaaattaatatgtagagtacgtgaaagatttattacccatcaacttaatttatgaattcttttgatgcatg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12383205 |
tcatggaaatcaaaggcaacggaattgcccaaattaatatgtagagtacgtgaaagatatattatccatcaacttaatttatgaattcttttgatgcatg |
12383106 |
T |
 |
| Q |
101 |
gacccatatgttttcaaaatgactatgactattgccaaacataaccatgcaatatgcatggcaatgcaaaaatacttataccctagtcatgattttggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12383105 |
gacccatatgttttcaaaatgactatgattattgccaaacataaccatgcaatatgcatggcaatgcaaaaatacttataccctagtcatgattttggat |
12383006 |
T |
 |
| Q |
201 |
ttaagt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
12383005 |
ttaagt |
12383000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 12362577 - 12362511
Alignment:
| Q |
163 |
aatgcaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat |
229 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12362577 |
aatgaaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat |
12362511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 12378929 - 12378863
Alignment:
| Q |
163 |
aatgcaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat |
229 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12378929 |
aatgaaaaaatacttataccctagtcatgattttggatttaagttggtgtggaccctttgtattaat |
12378863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University