View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6999_low_11 (Length: 218)
Name: NF6999_low_11
Description: NF6999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6999_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 7 - 144
Target Start/End: Complemental strand, 10759652 - 10759515
Alignment:
| Q |
7 |
ggagaggagatgagaaagtgaaatatgcaataatgtgttaatggtgattcaacataaggaactattagataagagagtcttattgtttgtctattaatta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10759652 |
ggagaggagatgagaaagtgaaatatgcaataatgtgttaatggtgattcaacataaggaactattagataagagagtcttactgtttgtctattaatta |
10759553 |
T |
|
| Q |
107 |
aaagtcagatatttccctaattgaaagctatattattg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10759552 |
aaagtcagatatttccctaattgaaagctatattattg |
10759515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University