View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6999_low_2 (Length: 345)
Name: NF6999_low_2
Description: NF6999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6999_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 9 - 327
Target Start/End: Original strand, 26001669 - 26001987
Alignment:
| Q |
9 |
tggtggtggagtgaaggaggataaggtgaatttggcgattgaggatctgattcctgaagggaagaagaataaaccgttttgggcgcgtggattggacgtg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26001669 |
tggtggtggagtgaaggaggataaggtgaatttggcgattgaggatctgattcctgaagggaagaagaataaaccgttttgggcgcgtggatttgacgtg |
26001768 |
T |
 |
| Q |
109 |
cttggttattcgcttaatgcgtttcggttttcgaatttgagtttcgtgaatgctgattcgccacgaaggagtaggatggtgaggctgcagctcaatgctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26001769 |
cttggttattcgcttaatgcgtttcggttttcgaatttgagtttcgtgaatgctgattcgccacgaaggagtaggatggtgaggttgcagctcaatgctg |
26001868 |
T |
 |
| Q |
209 |
atgaaaccaagaggttgcttgatgtgagtcactatcactctctcttttacgtttcgtttcgttgattatgtttcatttttgttggttatgctaagtatgc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
26001869 |
atgaaaccaagaggttgcttgatgtgagtcactatcactctctcttttacgtttcctttcgttaattatgttacatttttgttggttatgctaagtatgg |
26001968 |
T |
 |
| Q |
309 |
attattactacttctattt |
327 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26001969 |
attattactacttctattt |
26001987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University