View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6999_low_4 (Length: 325)
Name: NF6999_low_4
Description: NF6999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6999_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 118 - 314
Target Start/End: Original strand, 48883750 - 48883941
Alignment:
| Q |
118 |
ttgaaacgccaaaaaccttttgagtttttgcggaaatgtgtagtgtagtgtagtgttacagtactactcgtgttgttcaataataatcagcannnnnnng |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48883750 |
ttgaaacgccaaaaaccttttgagtttttgcggaaatgtgtagtgtagtgt-----tacagtactactcgtgttgttcaataataatcagcatttttttg |
48883844 |
T |
|
| Q |
218 |
gtaatattaatactttatagggggtgtatatggtaaagcgttactcctaattacagtctcccaaagttcttcttcccactgccgtttattgcttcat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883845 |
gtaatattaatactttatagggggtgtatatggtaaagcgttactcctaattacagtctcccaaagttcttcttcccactgccgtttattgcttcat |
48883941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 48883654 - 48883707
Alignment:
| Q |
18 |
agggttttggtacaatttgccccttctcgcttaagcttcttctcactgtgtagc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48883654 |
agggttttggtacaatttgccccttctcgcttaagcttcttctcactgtgtagc |
48883707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University